p63_AF043
(Plasmid
#175878)
-
Purposearabinose inducible luxI, AHL inducible tetR, constitutive mCherry
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 175878 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSEVA631
- Backbone size w/o insert (bp) 3000
- Total vector size (bp) 8089
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Gentamicin, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameAF043 cassette
-
SpeciesSynthetic
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ttctgtatgtgtcgtcggca
- 3′ sequencing primer GTTCTGAGGTCATTACTGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe araC-ParaBAD-mTagBFP2 cassette comes from plasmid pBAD-mTagBFP2 (Plasmid #34632). The luxI gene and the luxR-Plux cassette come from plasmid pTD103luxI_sfGFP (Plasmid #48885). The vector backbone came from the SEVA collection.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p63_AF043 was a gift from Chris Barnes (Addgene plasmid # 175878 ; http://n2t.net/addgene:175878 ; RRID:Addgene_175878) -
For your References section:
Single strain control of microbial consortia. Fedorec AJH, Karkaria BD, Sulu M, Barnes CP. Nat Commun. 2021 Mar 30;12(1):1977. doi: 10.1038/s41467-021-22240-x. 10.1038/s41467-021-22240-x PubMed 33785746