Skip to main content
Addgene

Halo-WIPI2B R108E
(Plasmid #176004)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 176004 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pHTN
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 6143
  • Total vector size (bp) 7410
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    WIPI2B (R108E)
  • Species
    H. sapiens (human)
  • Mutation
    Arginine 108 to Glutamate
  • Entrez Gene
    WIPI2 (a.k.a. ATG18B, Atg21, CGI-50, IDDSSA, WIPI-2)
  • Promoter CMV
  • Tag / Fusion Protein
    • HaloTag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer cctgatcggcagcgagatcg
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Sharon Tooze, Francis Crick Institute, UK
  • Article Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Halo-WIPI2B R108E was a gift from Erika Holzbaur (Addgene plasmid # 176004 ; http://n2t.net/addgene:176004 ; RRID:Addgene_176004)
  • For your References section:

    Expression of WIPI2B counteracts age-related decline in autophagosome biogenesis in neurons. Stavoe AK, Gopal PP, Gubas A, Tooze SA, Holzbaur EL. Elife. 2019 Jul 16;8. pii: 44219. doi: 10.7554/eLife.44219. 10.7554/eLife.44219 PubMed 31309927