Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pX459-dMET
(Plasmid #176031)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 176031 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pX459
  • Backbone manufacturer
    https://www.addgene.org/48139/
  • Backbone size w/o insert (bp) 3200
  • Total vector size (bp) 9200
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    A gRNA targeting the dog MET gene and the cDNA of Cas9
  • gRNA/shRNA sequence
    TGGGTGGAAGGATATGTCGC
  • Insert Size (bp)
    5000
  • Entrez Gene
    MET (a.k.a. c-Met)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX459-dMET was a gift from Michiyuki Matsuda (Addgene plasmid # 176031 ; http://n2t.net/addgene:176031 ; RRID:Addgene_176031)
  • For your References section:

    A feedback loop between lamellipodial extension and HGF-ERK signaling specifies leader cells during collective cell migration. Hino N, Matsuda K, Jikko Y, Maryu G, Sakai K, Imamura R, Tsukiji S, Aoki K, Terai K, Hirashima T, Trepat X, Matsuda M. Dev Cell. 2022 Oct 10;57(19):2290-2304.e7. doi: 10.1016/j.devcel.2022.09.003. Epub 2022 Sep 28. 10.1016/j.devcel.2022.09.003 PubMed 36174555