Skip to main content

pRedCm
(Plasmid #176225)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 176225 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pQE-30
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    The plasmid confers resistance to chloramphenicol only in absence of CI repressor of lambda phage.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Lambda Red operon under control of PrhaB promoter and cat under control of PL promoter of lambda phage
  • Promoter PrhaB and PL

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ctttttgcgtttctacaaactc
  • 3′ sequencing primer tggactcaagacgatagttac
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRedCm was a gift from Sergey Sineoky (Addgene plasmid # 176225 ; http://n2t.net/addgene:176225 ; RRID:Addgene_176225)
  • For your References section:

    Robust counterselection and advanced lambdaRed recombineering enable markerless chromosomal integration of large heterologous constructs. Bubnov DM, Yuzbashev TV, Khozov AA, Melkina OE, Vybornaya TV, Stan GB, Sineoky SP. Nucleic Acids Res. 2022 Aug 26;50(15):8947-8960. doi: 10.1093/nar/gkac649. 10.1093/nar/gkac649 PubMed 35920321