pTmpSm
(Plasmid
#176228)
-
PurposeA template plasmid for amplification of the cI-hok-strA cassette
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 176228 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMW118
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin and Streptomycin, 100 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namecI of phage lambda, hok of the R1 plasmid, strA
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site SmaI (not destroyed)
- 5′ sequencing primer cagggttttcccagtcacga
- 3′ sequencing primer atgttgtgtggaattgtgagc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTmpSm was a gift from Sergey Sineoky (Addgene plasmid # 176228 ; http://n2t.net/addgene:176228 ; RRID:Addgene_176228) -
For your References section:
Robust counterselection and advanced lambdaRed recombineering enable markerless chromosomal integration of large heterologous constructs. Bubnov DM, Yuzbashev TV, Khozov AA, Melkina OE, Vybornaya TV, Stan GB, Sineoky SP. Nucleic Acids Res. 2022 Aug 26;50(15):8947-8960. doi: 10.1093/nar/gkac649. 10.1093/nar/gkac649 PubMed 35920321