pAAV-SynI-CreOn-FlpOff-Kir2.1-P2A-EGFP
(Plasmid
#176278)
-
PurposeViral vector for co-expression of Kir2.1 and EGFP in cells expressing Cre AND NOT Flp driven by the human Synapsin promoter.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 176278 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV-SynI
-
Backbone manufacturerVector Builder
- Backbone size w/o insert (bp) 4638
- Total vector size (bp) 6714
-
Vector typeMammalian Expression, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKir2.1-P2A-EGFP
-
Alt nameKcnj2
-
SpeciesM. musculus (mouse), Synthetic
-
Insert Size (bp)2076
-
Entrez GeneKcnj2 (a.k.a. IRK1, Kcnf1, Kir2.1)
- Promoter human Synapsin I
-
Tag
/ Fusion Protein
- Myc (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CGTCGCCGTCCAGCTCGACCAG
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byMassimo Scanziani; Addgene #60598
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Several differences were found flanking/near the lox and frt sites. These base changes do not affect the coding sequence or recombination sites.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-SynI-CreOn-FlpOff-Kir2.1-P2A-EGFP was a gift from Martin Riccomagno (Addgene plasmid # 176278 ; http://n2t.net/addgene:176278 ; RRID:Addgene_176278) -
For your References section:
ExBoX - a simple Boolean exclusion strategy to drive expression in neurons. Ubina T, Vahedi-Hunter T, Agnew-Svoboda W, Wong W, Gupta A, Santhakumar V, Riccomagno MM. J Cell Sci. 2021 Oct 15;134(20). pii: 272538. doi: 10.1242/jcs.257212. Epub 2021 Oct 20. 10.1242/jcs.257212 PubMed 34515305