Skip to main content
Addgene

Hy_pMtnA FFLuc SV40
(Plasmid #176299)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 176299 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Hy_pMtnA eGFP
  • Total vector size (bp) 8865
  • Vector type
    Insect Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Firefly luciferase
  • Promoter MtnA
  • Tag / Fusion Protein
    • 3xFLAG (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CACTCGAATTTGGAGCCGGC
  • 3′ sequencing primer CTACCTGCCTGGACAGCATG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Hy_pMtnA FFLuc SV40 was a gift from Jeremy Wilusz (Addgene plasmid # 176299 ; http://n2t.net/addgene:176299 ; RRID:Addgene_176299)
  • For your References section:

    CRISPR/Cas13 effectors have differing extents of off-target effects that limit their utility in eukaryotic cells. Ai Y, Liang D, Wilusz JE. Nucleic Acids Res. 2022 Mar 4. pii: 6542487. doi: 10.1093/nar/gkac159. 10.1093/nar/gkac159 PubMed 35244715