-
PurposeCoexpression plasmid expressing Human PDI and Yeast Erv1p to aid the expression of disulfide-rich proteins in E. coli
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 176405 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepACYC184-TU2A-RFP
- Backbone size w/o insert (bp) 5068
- Total vector size (bp) 6527
-
Modifications to backboneModified pACYC184 for GoldenGate compatibility with an internal RFP gene for negative selection
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameMitochondrial FAD-linked sulfhydryl oxidase
-
Alt nameErv1p
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)189
-
MutationCodon optimised for expression in E. coli
-
GenBank IDNP_011543
-
Entrez GeneERV1 (a.k.a. YGR029W)
- Promoter T7 promoter
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site Esp3I (destroyed during cloning)
- 3′ cloning site Esp3I (destroyed during cloning)
- 5′ sequencing primer ATGAAGGCTATTGACAAGATGAC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameProtein disulfide isomerase
-
Alt namePDI
-
SpeciesH. sapiens (human)
-
Insert Size (bp)492
-
Mutationdeleted amino acids 2-17, codon optimised for expression in E. coli
-
GenBank IDNP_000909
- Promoter T7 promoter
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site Esp3I (destroyed during cloning)
- 3′ cloning site Esp3I (destroyed during cloning)
- 5′ sequencing primer ATGGACGCACCTGAAGAG
- 3′ sequencing primer CAATTCATCCTTTACTGCTTTCT
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2021.08.31.458447v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pACYC-T7CyDisCo was a gift from Simon Williams (Addgene plasmid # 176405) -
For your References section:
Optimised production of disulfide-bonded fungal effectors in E. coli using CyDisCo and FunCyDisCo co-expression approaches. Yu DS, Outram MA, Crean E, Smith A, Sung Y, Darma R, Sun X, Ma L, Jones DA, Solomon PS, Williams SJ. bioRxiv 2021.08.31.458447 10.1101/2021.08.31.458447