pACYC-T7CyDisCo
(Plasmid #176405)

• Purpose: Coexpression plasmid expressing Human PDI and Yeast Erv1p to aid the expression of disulfide-rich proteins in E. coli
• Depositing Lab: Simon Williams
• Publication: Yu et al bioRxiv 2021.08.31.458447

Backbone

• Vector backbone: pACYC184-TU2A-RFP
• Backbone size w/o insert (bp): 5068
• Total vector size (bp): 6527
• Modifications to backbone: Modified pACYC184 for GoldenGate compatibility with an internal RFP gene for negative selection
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: Mitochondrial FAD-linked sulfhydryl oxidase
• Alt name: Erv1p
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 189
• Mutation: Codon optimised for expression in E. coli
• GenBank ID: NP_011543
• Entrez Gene: ERV1 (a.k.a. YGR029W)
• Promoter: T7 promoter

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: Esp3I (destroyed during cloning)
• 3′ cloning site: Esp3I (destroyed during cloning)
• 5′ sequencing primer: ATGAAGGCTATTGACAAGATGAC

Gene/Insert 2

• Gene/Insert name: Protein disulfide isomerase
• Alt name: PDI
• Species: H. sapiens (human)
• Insert Size (bp): 492
• Mutation: deleted amino acids 2-17, codon optimised for expression in E. coli
• GenBank ID: NP_000909
• Promoter: T7 promoter

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: Esp3I (destroyed during cloning)
• 3′ cloning site: Esp3I (destroyed during cloning)
• 5′ sequencing primer: ATGGACGCACCTGAAGAG
• 3′ sequencing primer: CAATTCATCCTTTACTGCTTTCT

Resource Information

• Supplemental Documents:
  • pACYC-T7CyDisCo.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2021.08.31.458447v1 for bioRxiv preprint.