Skip to main content
Addgene

pCAG-mGas8-PA
(Plasmid #176468)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 176468 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCAG1.1
  • Backbone size w/o insert (bp) 5193
  • Total vector size (bp) 6645
  • Modifications to backbone
    pCAGGS was used as an original vector. PA sequence was added.
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    growth arrest specific 8
  • Alt name
    Gas8
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1452
  • Entrez Gene
    Gas8 (a.k.a. Gas, Gas11)
  • Tag / Fusion Protein
    • PA (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer GCCTTCTTCTTTTTCCTACAGC
  • 3′ sequencing primer GCCACACCAGCCACCACCTTCTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-mGas8-PA was a gift from Masahito Ikawa (Addgene plasmid # 176468 ; http://n2t.net/addgene:176468 ; RRID:Addgene_176468)
  • For your References section:

    Nexin-Dynein regulatory complex component DRC7 but not FBXL13 is required for sperm flagellum formation and male fertility in mice. Morohoshi A, Miyata H, Shimada K, Nozawa K, Matsumura T, Yanase R, Shiba K, Inaba K, Ikawa M. PLoS Genet. 2020 Jan 21;16(1):e1008585. doi: 10.1371/journal.pgen.1008585. eCollection 2020 Jan. 10.1371/journal.pgen.1008585 PubMed 31961863