pHR pUAS-dGFP pPGK-iRFP
(Plasmid
#176530)
-
PurposeLentiviral vector expressing a UAS-driven destabilized GFP, as well as a PGK promoter-driven iRFP marker.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 176530 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHR
- Backbone size w/o insert (bp) 8000
- Total vector size (bp) 2500
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namedGFP
-
Alt namedestabilized GFP
-
SpeciesSynthetic
-
Insert Size (bp)846
- Promoter UASp
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer gacattcgttggatcatggtgagcaagggcgag
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameiRFP
-
Alt nameinfrared fluorescent protein
-
SpeciesSynthetic
-
Insert Size (bp)948
- Promoter PGKp
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer cagcccaagcttaccatggctgaaggAtccgtcgcCAGGCAGCC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHR pUAS-dGFP pPGK-iRFP was a gift from Jared Toettcher (Addgene plasmid # 176530 ; http://n2t.net/addgene:176530 ; RRID:Addgene_176530) -
For your References section:
A synthetic gene circuit for imaging-free detection of signaling pulses. Ravindran PT, McFann S, Thornton RH, Toettcher JE. Cell Syst. 2022 Feb 16;13(2):131-142.e13. doi: 10.1016/j.cels.2021.10.002. Epub 2021 Nov 4. 10.1016/j.cels.2021.10.002 PubMed 34739875