Skip to main content

pET22b-T5-FB-E25TAG
(Plasmid #176545)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 176545 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET22b
  • Backbone size w/o insert (bp) 5608
  • Total vector size (bp) 5811
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    IgG affinity protein
  • Alt name
    FB
  • Species
    H. sapiens (human), M. musculus (mouse)
  • Insert Size (bp)
    204
  • Mutation
    change glutamic acid 25 to amber stop codon
  • Promoter T5
  • Tag / Fusion Protein
    • His tag (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATGGTGGACAATAAATTCAAC
  • 3′ sequencing primer TCAATGATGATGATGGTGGTGGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET22b-T5-FB-E25TAG was a gift from Han Xiao (Addgene plasmid # 176545 ; http://n2t.net/addgene:176545 ; RRID:Addgene_176545)
  • For your References section:

    Proximity-Induced Site-Specific Antibody Conjugation. Yu C, Tang J, Loredo A, Chen Y, Jung SY, Jain A, Gordon A, Xiao H. Bioconjug Chem. 2018 Nov 21;29(11):3522-3526. doi: 10.1021/acs.bioconjchem.8b00680. Epub 2018 Nov 1. 10.1021/acs.bioconjchem.8b00680 PubMed 30372039