pET22b-T5-FB-E25TAG-F6C
(Plasmid
#176546)
-
PurposeExpresses IgG affinity protein FB(F6C) with a TAG stop codon at E25 position
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 176546 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepET22b
- Backbone size w/o insert (bp) 5608
- Total vector size (bp) 5811
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameIgG affinity protein
-
Alt nameFB
-
SpeciesH. sapiens (human), M. musculus (mouse)
-
Insert Size (bp)204
-
Mutationchange phenylalanine 6 to cysteine; change glutamic acid 25 to amber stop codon
- Promoter T5
-
Tag
/ Fusion Protein
- His tag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGGTGGACAATAAATgtAA
- 3′ sequencing primer TCAATGATGATGATGGTGGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET22b-T5-FB-E25TAG-F6C was a gift from Han Xiao (Addgene plasmid # 176546 ; http://n2t.net/addgene:176546 ; RRID:Addgene_176546) -
For your References section:
Proximity-Induced Site-Specific Antibody Conjugation. Yu C, Tang J, Loredo A, Chen Y, Jung SY, Jain A, Gordon A, Xiao H. Bioconjug Chem. 2018 Nov 21;29(11):3522-3526. doi: 10.1021/acs.bioconjchem.8b00680. Epub 2018 Nov 1. 10.1021/acs.bioconjchem.8b00680 PubMed 30372039