p-sfGFP-pA-FRT-Amp-FRT
(Plasmid #176620)

• Purpose: for generating PCR templates with sfGFP and Amp for BAC recombination
• Depositing Lab: Nathan Lawson
• Publication: Shih et al Development. 2021 Nov 9. pii: 273393. doi: 10.1242/dev.200189.

Backbone

• Vector backbone: pEGFP-C1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 3700
• Total vector size (bp): 6371
• Vector type: Unspecified

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin and Kanamycin, 100 & 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: super folder green fluorescent protein with FRT-flanked ampicillin cassette
• Alt name: sfGFP-FRT-amp
• Species: Synthetic
• Insert Size (bp): 2700
• Mutation: H217R - please see dep. comments

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: TAATACGACTCACTATAGGG

Resource Information

• Supplemental Documents:
  • p-sfGFP-pA-FRT-Amp-FRT.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note depositor confirms H217R in insert does not affect plasmid function.