Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

p-sfGFP-pA-FRT-Amp-FRT
(Plasmid #176620)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 176620 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 3700
  • Total vector size (bp) 6371
  • Vector type
    Unspecified

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin and Kanamycin, 100 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    super folder green fluorescent protein with FRT-flanked ampicillin cassette
  • Alt name
    sfGFP-FRT-amp
  • Species
    Synthetic
  • Insert Size (bp)
    2700
  • Mutation
    H217R - please see dep. comments

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note depositor confirms H217R in insert does not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p-sfGFP-pA-FRT-Amp-FRT was a gift from Nathan Lawson (Addgene plasmid # 176620 ; http://n2t.net/addgene:176620 ; RRID:Addgene_176620)
  • For your References section:

    Integrated molecular analysis identifies a conserved pericyte gene signature in zebrafish. Shih YH, Portman D, Idrizi F, Grosse A, Lawson ND. Development. 2021 Nov 9. pii: 273393. doi: 10.1242/dev.200189. 10.1242/dev.200189 PubMed 34751773