pLIB-RSP23
(Plasmid
#176702)
-
PurposeExpression of Chlamydomonas reinhardtii RSP23 recombinant protein in insect cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 176702 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLIB
- Backbone size w/o insert (bp) 4886
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Mach1
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRSP23
-
SpeciesChlamydomonas reinhardtii
-
MutationNone
- Promoter polyhedrin
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGTAACAGTTTTGTAATAAAAAAACCTATAAATATTCCGG
- 3′ sequencing primer GCAAGTAAAACCTCTACAAATGTGGTATGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLIB-RSP23 was a gift from Ron Vale (Addgene plasmid # 176702 ; http://n2t.net/addgene:176702 ; RRID:Addgene_176702) -
For your References section:
Structure of the radial spoke head and insights into its role in mechanoregulation of ciliary beating. Grossman-Haham I, Coudray N, Yu Z, Wang F, Zhang N, Bhabha G, Vale RD. Nat Struct Mol Biol. 2021 Jan;28(1):20-28. doi: 10.1038/s41594-020-00519-9. Epub 2020 Dec 14. 10.1038/s41594-020-00519-9 PubMed 33318704