Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBR9-genomic_RSP6-HAX3
(Plasmid #176703)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 176703 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBR9
  • Backbone size w/o insert (bp) 4403
  • Vector type
    Plant Expression
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Mach1
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RSP6
  • Species
    Chlamydomonas reinhardtii
  • Mutation
    None
  • Promoter rbcs2
  • Tag / Fusion Protein
    • HAX3 (C terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GACCCtGAACttCGACctgc
  • 3′ sequencing primer TCACGACGTTGTAAAACGACGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBR9-genomic_RSP6-HAX3 was a gift from Ron Vale (Addgene plasmid # 176703 ; http://n2t.net/addgene:176703 ; RRID:Addgene_176703)
  • For your References section:

    Structure of the radial spoke head and insights into its role in mechanoregulation of ciliary beating. Grossman-Haham I, Coudray N, Yu Z, Wang F, Zhang N, Bhabha G, Vale RD. Nat Struct Mol Biol. 2021 Jan;28(1):20-28. doi: 10.1038/s41594-020-00519-9. Epub 2020 Dec 14. 10.1038/s41594-020-00519-9 PubMed 33318704