Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pYCTK003
(Plasmid #176707)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 176707 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pYTK001
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    P-FUS3
  • Species
    S. cerevisiae (budding yeast)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer CCTGGCCTTTTGCTGGCC
  • 3′ sequencing primer CCAGTAATGACCTCAGAACTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The part was cloned into the vector using Goden Gate. The plasmid is Golden Gate Cloning compatible. Please visit https://doi.org/10.1101/2021.09.27.462023 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pYCTK003 was a gift from Victor Sourjik (Addgene plasmid # 176707 ; http://n2t.net/addgene:176707 ; RRID:Addgene_176707)
  • For your References section:

    Construction of multicellular yeast networks using the communication toolkit with variable specificity and attenuation. Krink N, Loechner AC, Anders A, Kahnt J, Rensing S, Hochberg G, Sourjik V. bioRxiv 2021 10.1101/2021.09.27.462023