Skip to main content

pYCTK030
(Plasmid #176734)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 176734 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pYTK001
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    bar1Ca
  • Species
    Candida albicans
  • Mutation
    Codon-optimized for expression in S. cerevisiae

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer CCTGGCCTTTTGCTGGCC
  • 3′ sequencing primer CCAGTAATGACCTCAGAACTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The gene was codon-optimized for expression in S. cervisiae and cloned into the vector using Goden Gate. The plasmid is Golden Gate Cloning compatible. Please visit https://doi.org/10.1101/2021.09.27.462023 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pYCTK030 was a gift from Victor Sourjik (Addgene plasmid # 176734 ; http://n2t.net/addgene:176734 ; RRID:Addgene_176734)
  • For your References section:

    Construction of multicellular yeast networks using the communication toolkit with variable specificity and attenuation. Krink N, Loechner AC, Anders A, Kahnt J, Rensing S, Hochberg G, Sourjik V. bioRxiv 2021 10.1101/2021.09.27.462023