pYCTK034
(Plasmid #176738)

• Purpose: The plasmid is part of a GG toolkit for cell-cell communication in S. cerevisiae. This plasmid is an L0 part plasmid and contains the Bar1 gene of Saccharomyces cerevisiae (barrier part).
• Depositing Lab: Victor Sourjik
• Publication: Yeast communication toolkit - YCTK (unpublished)

Backbone

• Vector backbone: pYTK001
  (Search Vector Database)
• Vector type: Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: bar1Sc
• Species: S. cerevisiae (budding yeast)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsmBI (destroyed during cloning)
• 3′ cloning site: BsmBI (destroyed during cloning)
• 5′ sequencing primer: CCTGGCCTTTTGCTGGCC
• 3′ sequencing primer: CCAGTAATGACCTCAGAACTC

Resource Information

• Supplemental Documents:
  • pYCTK034.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The gene was codon-optimized for expression in S. cervisiae and cloned into the vector using Goden Gate. The plasmid is Golden Gate Cloning compatible.