pZac2.1 gfaABC1D-Ezr-BioID2-HA
(Plasmid
#176744)
-
PurposeExpresses Ezrin fused with BioID2 at the C-terminus in astrocytes
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 176744 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonePZac2.1
-
Backbone manufacturerKhakh lab
- Backbone size w/o insert (bp) 5109
- Total vector size (bp) 8595
-
Vector typeBacterial Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameEzr-BioID2-BioID2-HA
-
Alt nameEzr-BioID2-HA
-
SpeciesM. musculus (mouse); Aquifex aeolicus
-
Insert Size (bp)3486
-
GenBank ID
- Promoter gfaABC1D
-
Tag
/ Fusion Protein
- HA (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer taatacgactcactatagg
- 3′ sequencing primer gtggtttgtccaaactcatc
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byKyle Roux and Scott Soderling labs
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pZac2.1 gfaABC1D-Ezr-BioID2-HA was a gift from Baljit Khakh (Addgene plasmid # 176744 ; http://n2t.net/addgene:176744 ; RRID:Addgene_176744) -
For your References section:
Astrocyte-neuron subproteomes and obsessive-compulsive disorder mechanisms. Soto JS, Jami-Alahmadi Y, Chacon J, Moye SL, Diaz-Castro B, Wohlschlegel JA, Khakh BS. Nature. 2023 Apr;616(7958):764-773. doi: 10.1038/s41586-023-05927-7. Epub 2023 Apr 12. 10.1038/s41586-023-05927-7 PubMed 37046092