pAAV-DIO-CAG-TVA-P2A-dTomato
              
              
                (Plasmid
                
                #177016)
              
            
            
            
          - 
            PurposeFor expression of the avian TVA receptor in a cre-dependent manner
 - 
              Depositing Lab
 - 
          Publication
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 177016 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepAAV2
 - Backbone size w/o insert (bp) 5777
 - Total vector size (bp) 7004
 - 
              Vector typeMammalian Expression, AAV, Cre/Lox
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)NEB Stable
 - 
            Copy numberHigh Copy
 
Gene/Insert
- 
                Gene/Insert nameTVA-P2A-dTomato
 - 
                    SpeciesCoturnix japonica
 - 
                  Insert Size (bp)1227
 - 
                    GenBank IDL22753.1
 - 
                        Entrez GeneCD320
 - Promoter CAGGS
 - 
    
        Tag
        / Fusion Protein
    
- dTomato (C terminal on insert)
 
 
Cloning Information
- Cloning method Unknown
 - 5′ sequencing primer cctacagctcctgggcaacgtgc
 - 3′ sequencing primer CGCCACGTTGCCTGACAACGGGCC (Common Sequencing Primers)
 
Resource Information
- 
            
            
            Supplemental Documents
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
pAAV-DIO-CAG-TVA-P2A-dTomato was a gift from Peter Jonas (Addgene plasmid # 177016 ; http://n2t.net/addgene:177016 ; RRID:Addgene_177016)