Skip to main content

pEPQD0CM0818
(Plasmid #177020)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 177020 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUAP1
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    geranyl pyrophosphate synthase; geranyl diphosphate synthase
  • Species
    Picea abies (Norway spruce)
  • Mutation
    transit peptide removed

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer GGCGTATCACGAGGCAGAATTTC
  • 3′ sequencing primer CCTGCATAACGCGAAGTAATC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Genbank accession: GQ369788, transit peptide removed, the CDS sequence has been domesticated (all endogenous BpiI, BsaI, BsmBI and SapI recognition sites removed) and are flanked by an inverted pair of BsaI recognition sites that produce overhangs compatible with the phytobrick assembly standard

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEPQD0CM0818 was a gift from Nicola Patron (Addgene plasmid # 177020 ; http://n2t.net/addgene:177020 ; RRID:Addgene_177020)
  • For your References section:

    Reconstitution of monoterpene indole alkaloid biosynthesis in genome engineered Nicotiana benthamiana. Dudley QM, Jo S, Guerrero DAS, Chhetry M, Smedley MA, Harwood WA, Sherden NH, O'Connor SE, Caputi L, Patron NJ. Commun Biol. 2022 Sep 10;5(1):949. doi: 10.1038/s42003-022-03904-w. 10.1038/s42003-022-03904-w PubMed 36088516