pEPQDPKN0892
(Plasmid
#177089)
-
PurposeMoClo Level P, position 1, plasmid containing multiple transcriptional units for transient expression of CrISY, NmMLPL, CrG8H, CrGOR, CrIO, and Cr7-DLGT driven by 4x opaatB
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 177089 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepICSL4723-P1
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCrISY, NmMLPL, CrG8H, CrGOR, CrIO, and Cr7-DLGT
-
Alt nameLP 4X opattB middle iridiod cytosol v2
-
SpeciesOther
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer GTGGTGTAAACAAATTGACGC
- 3′ sequencing primer GGATAAACCTTTTCACGCCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
LP 4X opattB middle iridiod cytosol v2: P1_4X opattB-TMV-CrISY-35Sterm + P2_4X opattB-TMV-NmMLP-masterm + P3_4X opattB-TMV-CrG8H-ocsterm + P4_4X opattB-TMV-Cr8HGO/GOR-g7term + P5_4X opattB-TMV-CrIO-35Sterm + P6_4X opattB-TMV-Cr7DLGT-nosterm
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEPQDPKN0892 was a gift from Nicola Patron (Addgene plasmid # 177089 ; http://n2t.net/addgene:177089 ; RRID:Addgene_177089) -
For your References section:
Reconstitution of monoterpene indole alkaloid biosynthesis in genome engineered Nicotiana benthamiana. Dudley QM, Jo S, Guerrero DAS, Chhetry M, Smedley MA, Harwood WA, Sherden NH, O'Connor SE, Caputi L, Patron NJ. Commun Biol. 2022 Sep 10;5(1):949. doi: 10.1038/s42003-022-03904-w. 10.1038/s42003-022-03904-w PubMed 36088516