pGEX4T3-GST-PolB(K206A/K244A)
(Plasmid
#177135)
-
PurposeBacterial vector for expression of an N-terminal GST fusion of PolB(K206A/K244A) with a TEV protease site located between the GST tag and PolB(K206A/K244A)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 177135 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepGEX4T3
-
Backbone manufacturerSigma
- Total vector size (bp) 5993
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsuse BL21-Codonplus-RP for protein expression
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePolB
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1005
- Promoter Tac
-
Tag
/ Fusion Protein
- GST (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer TCCCGGGTCGACATGAGCAAACGGAAGGCGCCG
- 3′ sequencing primer CACGATGCGGCCGCTCATTCGCTCCGGTCCTTGGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEX4T3-GST-PolB(K206A/K244A) was a gift from Robert Sobol (Addgene plasmid # 177135 ; http://n2t.net/addgene:177135 ; RRID:Addgene_177135) -
For your References section:
Stability and sub-cellular localization of DNA polymerase beta is regulated by interactions with NQO1 and XRCC1 in response to oxidative stress. Fang Q, Andrews J, Sharma N, Wilk A, Clark J, Slyskova J, Koczor CA, Lans H, Prakash A, Sobol RW. Nucleic Acids Res. 2019 Jul 9;47(12):6269-6286. doi: 10.1093/nar/gkz293. 10.1093/nar/gkz293 PubMed 31287140