pLentiGuide-PolB1-puro
              
              
                (Plasmid
                
                #177146)
              
            
            
            
          - 
            PurposeLentiviral vector expressing PolB-gRNA-1 and a puromycin resistance cassette
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 177146 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backboneLentivirus
- 
              Backbone manufacturerAddgene
- Total vector size (bp) 8323
- 
              Modifications to backbonepLentiCRISPRguide
- 
              Vector typeMammalian Expression, Lentiviral
- 
                Selectable markersPuromycin
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)NEB Stable
- 
            Copy numberUnknown
Gene/Insert
- 
                Gene/Insert namePolBgRNA1
- 
                    gRNA/shRNA sequenceGAGCAAACGGAAGGCGCCG
- 
                    SpeciesH. sapiens (human)
- 
                        Entrez GenePOLB
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (unknown if destroyed)
- 3′ cloning site BsmBI (unknown if destroyed)
- 5′ sequencing primer CACCGGAGCAAACGGAAGGCGCCGC
- 3′ sequencing primer AAACGCGGCGCCTTCCGTTTGCTCC (Common Sequencing Primers)
Resource Information
- 
            
            
            Supplemental Documents
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pLentiGuide-PolB1-puro was a gift from Robert Sobol (Addgene plasmid # 177146 ; http://n2t.net/addgene:177146 ; RRID:Addgene_177146)
- 
                For your References section: Stability and sub-cellular localization of DNA polymerase beta is regulated by interactions with NQO1 and XRCC1 in response to oxidative stress. Fang Q, Andrews J, Sharma N, Wilk A, Clark J, Slyskova J, Koczor CA, Lans H, Prakash A, Sobol RW. Nucleic Acids Res. 2019 Jul 9;47(12):6269-6286. doi: 10.1093/nar/gkz293. 10.1093/nar/gkz293 PubMed 31287140
 
    
 
                         
             
            