pUCHR-mClover-MT-C34
(Plasmid
#177153)
-
PurposeLentiviral vector for expression of anti-HIV-1 MT-C34 peptide on cell surface
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 177153 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepUCHR
- Backbone size w/o insert (bp) 6389
- Total vector size (bp) 7556
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemClover-MT-C34
-
Insert Size (bp)1167
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AfeI (not destroyed)
- 3′ cloning site PspXI (not destroyed)
- 5′ sequencing primer gatcacatggtcctgctggag
- 3′ sequencing primer cttcgttgggagtgaattagcc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUCHR-mClover-MT-C34 was a gift from Dmitriy Mazurov (Addgene plasmid # 177153 ; http://n2t.net/addgene:177153 ; RRID:Addgene_177153) -
For your References section:
Engineering T-Cell Resistance to HIV-1 Infection via Knock-In of Peptides from the Heptad Repeat 2 Domain of gp41. Maslennikova A, Kruglova N, Kalinichenko S, Komkov D, Shepelev M, Golubev D, Siniavin A, Vzorov A, Filatov A, Mazurov D. mBio. 2022 Jan 25:e0358921. doi: 10.1128/mbio.03589-21. 10.1128/mbio.03589-21 PubMed 35073736