Skip to main content

pUCHR-mClover-MT-C34
(Plasmid #177153)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 177153 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUCHR
  • Backbone size w/o insert (bp) 6389
  • Total vector size (bp) 7556
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mClover-MT-C34
  • Insert Size (bp)
    1167
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AfeI (not destroyed)
  • 3′ cloning site PspXI (not destroyed)
  • 5′ sequencing primer gatcacatggtcctgctggag
  • 3′ sequencing primer cttcgttgggagtgaattagcc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUCHR-mClover-MT-C34 was a gift from Dmitriy Mazurov (Addgene plasmid # 177153 ; http://n2t.net/addgene:177153 ; RRID:Addgene_177153)
  • For your References section:

    Engineering T-Cell Resistance to HIV-1 Infection via Knock-In of Peptides from the Heptad Repeat 2 Domain of gp41. Maslennikova A, Kruglova N, Kalinichenko S, Komkov D, Shepelev M, Golubev D, Siniavin A, Vzorov A, Filatov A, Mazurov D. mBio. 2022 Jan 25:e0358921. doi: 10.1128/mbio.03589-21. 10.1128/mbio.03589-21 PubMed 35073736