pLenti PKAKTRn-Clover
(Plasmid
#177200)
-
PurposeLentiviral vector encoding PKAKTRnew-Clover
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 177200 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLenti PGK Puro
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePKAKTRnew-mClover
-
SpeciesSynthetic
- Promoter PGK
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CGTCGCCGTCCAGCTCGACCAG
- 3′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti PKAKTRn-Clover was a gift from Markus Covert (Addgene plasmid # 177200 ; http://n2t.net/addgene:177200 ; RRID:Addgene_177200) -
For your References section:
A multiplexed epitope barcoding strategy that enables dynamic cellular phenotypic screens. Kudo T, Lane K, Covert MW. Cell Syst. 2022 May 18;13(5):376-387.e8. doi: 10.1016/j.cels.2022.02.006. Epub 2022 Mar 21. 10.1016/j.cels.2022.02.006 PubMed 35316656