pSUC01
(Plasmid
#177204)
-
Purposechromogenic reporter for gene knockout in Streptomyces
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 177204 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSET152
- Backbone size w/o insert (bp) 5500
- Total vector size (bp) 7959
-
Modifications to backbonethe integrase gene int phiC31 was removed
-
Vector typeBacterial Expression, Synthetic Biology
-
Selectable markersnone
Growth in Bacteria
-
Bacterial Resistance(s)Apramycin, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsnone
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameSaindC
-
Alt nameindS
-
SpeciesStreptomyces albidoflavus
-
Insert Size (bp)3927
-
MutationNONE
-
GenBank ID
- Promoter TGTTCACATTCGAACGGTCTCTGCTTTGACAACATGCTGTGCGGTGTTGTAAAGTCGTGGCCAGGAGAATACGACAGCGTGCAGGACTGGGGGAGTT
-
Tag
/ Fusion Protein
- NONE
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gaatcttcgctgaagtc
- 3′ sequencing primer gtcatagctgtttcctg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSUC01 was a gift from Wenjun Guan (Addgene plasmid # 177204 ; http://n2t.net/addgene:177204 ; RRID:Addgene_177204) -
For your References section:
An Efficient Markerless Deletion System Suitable for the Industrial Strains of Streptomyces. Dong J, Wei J, Li H, Zhao S, Guan W. J Microbiol Biotechnol. 2021 Dec 28;31(12):1722-1731. doi: 10.4014/jmb.2106.06083. 10.4014/jmb.2106.06083 PubMed 34489377