pSUC01
(Plasmid #177204)

• Purpose: chromogenic reporter for gene knockout in Streptomyces
• Depositing Lab: Wenjun Guan
• Publication: Dong et al J Microbiol Biotechnol. 2021 Dec 28;31(12):1722-1731. doi: 10.4014/jmb.2106.06083.

Backbone

• Vector backbone: pSET152
• Backbone size w/o insert (bp): 5500
• Total vector size (bp): 7959
• Modifications to backbone: the integrase gene int phiC31 was removed
• Vector type: Bacterial Expression, Synthetic Biology
• Selectable markers: none

Growth in Bacteria

• Bacterial Resistance(s): Apramycin, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: none
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: SaindC
• Alt name: indS
• Species: Streptomyces albidoflavus
• Insert Size (bp): 3927
• Mutation: NONE
• GenBank ID:
• Promoter: TGTTCACATTCGAACGGTCTCTGCTTTGACAACATGCTGTGCGGTGTTGTAAAGTCGTGGCCAGGAGAATACGACAGCGTGCAGGACTGGGGGAGTT
• Tag / Fusion Protein:
  • NONE

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gaatcttcgctgaagtc
• 3′ sequencing primer: gtcatagctgtttcctg

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry