bU6-sgNeo1-mU6-sgNT-hU6-sgLkb1_2nd
(Plasmid
#177230)
-
PurposeExpresses Neomycin(bU6), non-targeting (mU6) and Lkb1 (hU6) gRNAs and Cre-recombinase
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 177230 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLL3.3
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgNeo1/sgNT1/sgLkb1_2nd
-
gRNA/shRNA sequenceTCATGGCTGATGCAATGCGG/GCGAGGTATTCGGCTCCGCG/AAGCTGCGCAGGATCCCCAA
-
SpeciesM. musculus (mouse)
- Promoter bU6/mU6/hU6
Cloning Information
- Cloning method Gibson Cloning
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
bU6-sgNeo1-mU6-sgNT-hU6-sgLkb1_2nd was a gift from Monte Winslow (Addgene plasmid # 177230 ; http://n2t.net/addgene:177230 ; RRID:Addgene_177230)