Skip to main content

hu6-sgCebpb_v1 (opti)
(Plasmid #177247)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 177247 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLL3.3
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgCebpb_1st
  • gRNA/shRNA sequence
    GATGGGTCTAAAGGCGGCGGG
  • Species
    M. musculus (mouse)
  • Promoter hU6

Cloning Information

  • Cloning method Ligation Independent Cloning

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    hu6-sgCebpb_v1 (opti) was a gift from Monte Winslow (Addgene plasmid # 177247 ; http://n2t.net/addgene:177247 ; RRID:Addgene_177247)
  • For your References section:

    LKB1 drives stasis and C/EBP-mediated reprogramming to an alveolar type II fate in lung cancer. Murray CW, Brady JJ, Han M, Cai H, Tsai MK, Pierce SE, Cheng R, Demeter J, Feldser DM, Jackson PK, Shackelford DB, Winslow MM. Nat Commun. 2022 Feb 28;13(1):1090. doi: 10.1038/s41467-022-28619-8. 10.1038/s41467-022-28619-8 PubMed 35228570