mU6-sgCebpa_v2-hu6-sgCebpd_v2
(Plasmid
#177254)
-
PurposeExpresses Cebpa_v2 (mU6), Cebpd_v2(hU6) gRNAs and Cre-recombinase
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 177254 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLL3.3
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgCebpa_v2/sgCebpd_v2
-
gRNA/shRNA sequenceGCATCAGCGCCTACATCGACC/GTCGTACATGGCAGGAGTCG
-
SpeciesM. musculus (mouse)
- Promoter mU6/hU6
Cloning Information
- Cloning method Gibson Cloning
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mU6-sgCebpa_v2-hu6-sgCebpd_v2 was a gift from Monte Winslow (Addgene plasmid # 177254 ; http://n2t.net/addgene:177254 ; RRID:Addgene_177254) -
For your References section:
LKB1 drives stasis and C/EBP-mediated reprogramming to an alveolar type II fate in lung cancer. Murray CW, Brady JJ, Han M, Cai H, Tsai MK, Pierce SE, Cheng R, Demeter J, Feldser DM, Jackson PK, Shackelford DB, Winslow MM. Nat Commun. 2022 Feb 28;13(1):1090. doi: 10.1038/s41467-022-28619-8. 10.1038/s41467-022-28619-8 PubMed 35228570