Skip to main content

pLentiCRISPRv2-dADAM17 (#1)
(Plasmid #177259)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 177259 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    LentiCRISPRv2puro
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    A gRNA targeting the dog Adam17 gene and the cDNA of CRISPR-Cas9
  • gRNA/shRNA sequence
    GTGGAGTGCAGTGACAGACA

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLentiCRISPRv2-dADAM17 (#1) was a gift from Michiyuki Matsuda (Addgene plasmid # 177259 ; http://n2t.net/addgene:177259 ; RRID:Addgene_177259)
  • For your References section:

    Redundant roles of EGFR ligands in the ERK activation waves during collective cell migration. Lin S, Hirayama D, Maryu G, Matsuda K, Hino N, Deguchi E, Aoki K, Iwamoto R, Terai K, Matsuda M. Life Sci Alliance. 2021 Oct 19;5(1). pii: 5/1/e202101206. doi: 10.26508/lsa.202101206. Print 2022 Jan. 10.26508/lsa.202101206 PubMed 34667080