Skip to main content

pACE-Truncated-Kir3.2-StreptagII
(Plasmid #177263)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 177263 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pACEBac1
  • Backbone manufacturer
    Geneva Biotech
  • Total vector size (bp) 3714
  • Vector type
    Insect Expression
  • Selectable markers
    Gentamicin

Growth in Bacteria

  • Bacterial Resistance(s)
    Gentamicin, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    G-protein-gated inward rectifying potassium channel 2
  • Alt name
    GIRK2
  • Alt name
    Kir3.2
  • Species
    H. sapiens (human)
  • Mutation
    Residues 49-378
  • Entrez Gene
    KCNJ6 (a.k.a. BIR1, GIRK-2, GIRK2, KATP-2, KATP2, KCNJ7, KIR3.2, KPLBS, hiGIRK2)
  • Promoter polyhedrin promoter
  • Tag / Fusion Protein
    • StreptagII (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gatcatggagataattaaaatgataaccatctcgc
  • 3′ sequencing primer GAAATTTGTGATGCTATTGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pACE-Truncated-Kir3.2-StreptagII was a gift from Arthur Laganowsky (Addgene plasmid # 177263 ; http://n2t.net/addgene:177263 ; RRID:Addgene_177263)
  • For your References section:

    Entropy in the Molecular Recognition of Membrane Protein-Lipid Interactions. Qiao P, Schrecke S, Walker T, McCabe JW, Lyu J, Zhu Y, Zhang T, Kumar S, Clemmer D, Russell DH, Laganowsky A. J Phys Chem Lett. 2021 Dec 30;12(51):12218-12224. doi: 10.1021/acs.jpclett.1c03750. Epub 2021 Dec 20. 10.1021/acs.jpclett.1c03750 PubMed 34928154