pACE-Truncated-Kir3.2-StreptagII
(Plasmid
#177263)
-
PurposeExpresses a truncated from of human Kir3.2 with a C-terminal streptagII in insect cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 177263 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepACEBac1
-
Backbone manufacturerGeneva Biotech
- Total vector size (bp) 3714
-
Vector typeInsect Expression
-
Selectable markersGentamicin
Growth in Bacteria
-
Bacterial Resistance(s)Gentamicin, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameG-protein-gated inward rectifying potassium channel 2
-
Alt nameGIRK2
-
Alt nameKir3.2
-
SpeciesH. sapiens (human)
-
MutationResidues 49-378
-
Entrez GeneKCNJ6 (a.k.a. BIR1, GIRK-2, GIRK2, KATP-2, KATP2, KCNJ7, KIR3.2, KPLBS, hiGIRK2)
- Promoter polyhedrin promoter
-
Tag
/ Fusion Protein
- StreptagII (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gatcatggagataattaaaatgataaccatctcgc
- 3′ sequencing primer GAAATTTGTGATGCTATTGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pACE-Truncated-Kir3.2-StreptagII was a gift from Arthur Laganowsky (Addgene plasmid # 177263 ; http://n2t.net/addgene:177263 ; RRID:Addgene_177263) -
For your References section:
Entropy in the Molecular Recognition of Membrane Protein-Lipid Interactions. Qiao P, Schrecke S, Walker T, McCabe JW, Lyu J, Zhu Y, Zhang T, Kumar S, Clemmer D, Russell DH, Laganowsky A. J Phys Chem Lett. 2021 Dec 30;12(51):12218-12224. doi: 10.1021/acs.jpclett.1c03750. Epub 2021 Dec 20. 10.1021/acs.jpclett.1c03750 PubMed 34928154