Skip to main content

pYTRW18K_3T5
(Plasmid #177288)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 177288 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pYTRW09K_0T5
  • Backbone size w/o insert (bp) 10451
  • Vector type
    Bacterial Expression, Synthetic Biology ; Yeast Expression, Tn5 genomic integration
  • Selectable markers
    URA3 ; Tetracycline

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    mCherry
  • Alt name
    promotorless mCherry
  • Alt name
    Red fluorescent protein
  • Species
    Discosoma sp.
  • Insert Size (bp)
    740

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CTCAATCTCGCGCTATTGTG
  • 3′ sequencing primer CCATGGACGCGTAGTCGTAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Jaeger Lab (from pAra-mCherry)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Part of the pYT vector series which facilitates chromosomal integration via Tn5 tranposition with selection on tetracycline and transcriptional reporter mCherry (https://www.fpbase.org/protein/mcherry/; methods: flow cytometry, fluorescence visualisation, fluorescence measurements). Target genes can be inserted at the I-SceI site.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pYTRW18K_3T5 was a gift from Karl-Erich Jaeger (Addgene plasmid # 177288 ; http://n2t.net/addgene:177288 ; RRID:Addgene_177288)
  • For your References section:

    The modular pYT vector series employed for chromosomal gene integration and expression to produce carbazoles and glycolipids in P. putida. Weihmann R, Kubicki S, Bitzenhofer NL, Domrose A, Bator I, Kirschen LM, Kofler F, Funk A, Tiso T, Blank LM, Jaeger KE, Drepper T, Thies S, Loeschcke A. FEMS Microbes. 2022 Dec 19;4:xtac030. doi: 10.1093/femsmc/xtac030. eCollection 2023. 10.1093/femsmc/xtac030 PubMed 37333445