pYTRW20K_0Ti1
(Plasmid #177289)

• Purpose: genomic integration of genes (inserted in I-SceI-site) via rrn-interposon with TcR
• Depositing Lab: Karl-Erich Jaeger
• Publication: Weihmann et al FEMS Microbes. 2022 Dec 19;4:xtac030. doi: 10.1093/femsmc/xtac030. eCollection 2023.

Backbone

• Vector backbone: yTREX backbone
• Backbone size w/o insert (bp): 9145
• Vector type: Bacterial Expression, Synthetic Biology ; Yeast Expression, rrn genomic integration
• Selectable markers: URA3 ; Tetracycline

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Ptet-tetA(C)
• Alt name: tetracycline resistance module - TcR
• Alt name: Tetracycline efflux pump
• Species: Synthetic
• Insert Size (bp): 1273

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CCTCAATACGTGCTGCAAC
• 3′ sequencing primer: GCCAAATTGCGTCAAGATCC

Resource Information

• Supplemental Documents:
  • pYTRW20K_0Ti1.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Part of the pYT vector series which enables chromosomal interposon integration via HR in synthetic rrn "landing pads" within 16S rRNA genes of equipped strains. The vector carries the "empty" YT_core with specific cloning slots separated by designated upstream and downstream sequences for integron customization, with TcR marker. Target genes can be inserted at the I-SceI site; additional promoter or reporter elements may be integrated at further positions. The vector backbone, based on the yTREX vector, is equipped with the bacterial pMB1 ori, aphII-encoded KmR and mob gene from pBBR1 (promoter and oriT region) and with yeast replication elements CEN4-ARS1 and URA3 marker. Note: vector pYTRW0268K_0Ti1 also has SacB for counter selection.