pYTRW20K_0Ti1
(Plasmid
#177289)
-
Purposegenomic integration of genes (inserted in I-SceI-site) via rrn-interposon with TcR
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 177289 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneyTREX backbone
- Backbone size w/o insert (bp) 9145
-
Vector typeBacterial Expression, Synthetic Biology ; Yeast Expression, rrn genomic integration
-
Selectable markersURA3 ; Tetracycline
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namePtet-tetA(C)
-
Alt nametetracycline resistance module - TcR
-
Alt nameTetracycline efflux pump
-
SpeciesSynthetic
-
Insert Size (bp)1273
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CCTCAATACGTGCTGCAAC
- 3′ sequencing primer GCCAAATTGCGTCAAGATCC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Part of the pYT vector series which enables chromosomal interposon integration via HR in synthetic rrn "landing pads" within 16S rRNA genes of equipped strains. The vector carries the "empty" YT_core with specific cloning slots separated by designated upstream and downstream sequences for integron customization, with TcR marker. Target genes can be inserted at the I-SceI site; additional promoter or reporter elements may be integrated at further positions. The vector backbone, based on the yTREX vector, is equipped with the bacterial pMB1 ori, aphII-encoded KmR and mob gene from pBBR1 (promoter and oriT region) and with yeast replication elements CEN4-ARS1 and URA3 marker. Note: vector pYTRW0268K_0Ti1 also has SacB for counter selection.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pYTRW20K_0Ti1 was a gift from Karl-Erich Jaeger (Addgene plasmid # 177289 ; http://n2t.net/addgene:177289 ; RRID:Addgene_177289) -
For your References section:
The modular pYT vector series employed for chromosomal gene integration and expression to produce carbazoles and glycolipids in P. putida. Weihmann R, Kubicki S, Bitzenhofer NL, Domrose A, Bator I, Kirschen LM, Kofler F, Funk A, Tiso T, Blank LM, Jaeger KE, Drepper T, Thies S, Loeschcke A. FEMS Microbes. 2022 Dec 19;4:xtac030. doi: 10.1093/femsmc/xtac030. eCollection 2023. 10.1093/femsmc/xtac030 PubMed 37333445