Skip to main content

pYTRW21K_1Ti1
(Plasmid #177291)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 177291 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pYTRW20K_0Ti1
  • Backbone size w/o insert (bp) 10418
  • Vector type
    Bacterial Expression, Synthetic Biology ; Yeast Expression, rrn genomic integration
  • Selectable markers
    URA3 ; Tetracycline

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    eYFP
  • Alt name
    promotorless eYFP
  • Alt name
    Yellow fluorescent protein
  • Species
    Aequorea victoria
  • Insert Size (bp)
    749

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CTCAATCTCGCGCTATTGTG
  • 3′ sequencing primer CCATGGACGCGTAGTCGTAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Troost et al (pRhon5Hi-2-eyfp in PMID: 31555236)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Part of the pYT vector series which facilitates chromosomal interposon integration in rrn "landing pads" with selection on tetracyline and transcriptional reporter eYFP (https://www.fpbase.org/protein/eyfp/; methods: flow cytometry, fluorescence visualisation, fluorescence measurements). Target genes can be inserted at the I-SceI site. Note that vector pYTRW026K_1Ti1 is additionally equipped with SacB for counter selection.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pYTRW21K_1Ti1 was a gift from Karl-Erich Jaeger (Addgene plasmid # 177291 ; http://n2t.net/addgene:177291 ; RRID:Addgene_177291)
  • For your References section:

    The modular pYT vector series employed for chromosomal gene integration and expression to produce carbazoles and glycolipids in P. putida. Weihmann R, Kubicki S, Bitzenhofer NL, Domrose A, Bator I, Kirschen LM, Kofler F, Funk A, Tiso T, Blank LM, Jaeger KE, Drepper T, Thies S, Loeschcke A. FEMS Microbes. 2022 Dec 19;4:xtac030. doi: 10.1093/femsmc/xtac030. eCollection 2023. 10.1093/femsmc/xtac030 PubMed 37333445