pYTRW21K_1Ti1
(Plasmid
#177291)
-
Purposegenomic integration of genes (inserted in I-SceI-site) via rrn-interposon with TcR and eYFP
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 177291 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepYTRW20K_0Ti1
- Backbone size w/o insert (bp) 10418
-
Vector typeBacterial Expression, Synthetic Biology ; Yeast Expression, rrn genomic integration
-
Selectable markersURA3 ; Tetracycline
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameeYFP
-
Alt namepromotorless eYFP
-
Alt nameYellow fluorescent protein
-
SpeciesAequorea victoria
-
Insert Size (bp)749
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CTCAATCTCGCGCTATTGTG
- 3′ sequencing primer CCATGGACGCGTAGTCGTAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byTroost et al (pRhon5Hi-2-eyfp in PMID: 31555236)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Part of the pYT vector series which facilitates chromosomal interposon integration in rrn "landing pads" with selection on tetracyline and transcriptional reporter eYFP (https://www.fpbase.org/protein/eyfp/; methods: flow cytometry, fluorescence visualisation, fluorescence measurements). Target genes can be inserted at the I-SceI site. Note that vector pYTRW026K_1Ti1 is additionally equipped with SacB for counter selection.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pYTRW21K_1Ti1 was a gift from Karl-Erich Jaeger (Addgene plasmid # 177291 ; http://n2t.net/addgene:177291 ; RRID:Addgene_177291) -
For your References section:
The modular pYT vector series employed for chromosomal gene integration and expression to produce carbazoles and glycolipids in P. putida. Weihmann R, Kubicki S, Bitzenhofer NL, Domrose A, Bator I, Kirschen LM, Kofler F, Funk A, Tiso T, Blank LM, Jaeger KE, Drepper T, Thies S, Loeschcke A. FEMS Microbes. 2022 Dec 19;4:xtac030. doi: 10.1093/femsmc/xtac030. eCollection 2023. 10.1093/femsmc/xtac030 PubMed 37333445