pYTSK65K_8G7
(Plasmid
#177303)
-
Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn7 with GmR and GUS
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 177303 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepYTSK01K_0G7
- Backbone size w/o insert (bp) 15436
-
Vector typeBacterial Expression, Synthetic Biology ; Yeast Expression, Tn7 genomic integration
-
Selectable markersGentamicin ; URA3
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameuidA
-
Alt namepromotorless GUS
-
Alt nameBeta-glucuronidase
-
SpeciesEscherichia coli
-
Insert Size (bp)1833
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CTCAATCTCGCGCTATTGTG
- 3′ sequencing primer GCCAAATTGCGTCAAGATCC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Part of the pYT vector series which facilitates chromosomal integration in attTn7-site with selection on gentamicin and transcriptional reporter GUS (https://www.uniprot.org/uniprot/P05804; methods: X-Gluc-assay, pNPG-assay). Target expression cassettes can be inserted at the I-SceI site.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pYTSK65K_8G7 was a gift from Karl-Erich Jaeger (Addgene plasmid # 177303 ; http://n2t.net/addgene:177303 ; RRID:Addgene_177303) -
For your References section:
The modular pYT vector series employed for chromosomal gene integration and expression to produce carbazoles and glycolipids in P. putida. Weihmann R, Kubicki S, Bitzenhofer NL, Domrose A, Bator I, Kirschen LM, Kofler F, Funk A, Tiso T, Blank LM, Jaeger KE, Drepper T, Thies S, Loeschcke A. FEMS Microbes. 2022 Dec 19;4:xtac030. doi: 10.1093/femsmc/xtac030. eCollection 2023. 10.1093/femsmc/xtac030 PubMed 37333445