Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBT009.J1.J306
(Plasmid #177325)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 177325 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    ColE1

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    J306
  • gRNA/shRNA sequence
    ACGGAGCGTTCTGGACACAA

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBT009.J1.J306 was a gift from James Carothers (Addgene plasmid # 177325 ; http://n2t.net/addgene:177325 ; RRID:Addgene_177325)
  • For your References section:

    Multi-layer CRISPRa/i circuits for dynamic genetic programs in cell-free and bacterial systems. Tickman BI, Burbano DA, Chavali VP, Kiattisewee C, Fontana J, Khakimzhan A, Noireaux V, Zalatan JG, Carothers JM. Cell Syst. 2021 Nov 17. pii: S2405-4712(21)00419-1. doi: 10.1016/j.cels.2021.10.008. 10.1016/j.cels.2021.10.008 PubMed 34800362