AAV-CMV-dSaCas9-NLS-3xHA-3xSunTag_bGHpA
(Plasmid
#177342)
-
PurposeAAV expression of a catalytically inactive SaCas9 (dSaCas9) fused with three copies of SunTag sequence
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 177342 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepX603-AAV-CMV::NLS-dSaCas9(D10A,N580A)-NLS-3xHA-bGHpA
-
Backbone manufacturerAddgene
- Backbone size w/o insert (bp) 2879
- Total vector size (bp) 7533
-
Vector typeMammalian Expression, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedead hSaCas9
-
Alt namedead Cas9 from Staphylococcus aureus
-
SpeciesSynthetic; Staphylococcus aureus
-
Insert Size (bp)4654
-
MutationD10A, N580A
- Promoter CMV
-
Tags
/ Fusion Proteins
- 3x GCN4 peptide (C terminal on insert)
- 3xHA (C terminal on insert)
- NLS (C terminal on insert)
- NLS (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer ctatataagcagagctctctggctaac
- 3′ sequencing primer GATCAAGATCAACGGCGA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bypX603-AAV-CMV::NLS-dSaCas9(D10A,N580A)-NLS-3xHA-bGHpA was a gift from Feng Zhang (Addgene plasmid # 61594 ; http://n2t.net/addgene:61594 ; RRID:Addgene_61594)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.21203/rs.3.rs-1065603/v1 for preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-CMV-dSaCas9-NLS-3xHA-3xSunTag_bGHpA was a gift from Naoki Yamamoto (Addgene plasmid # 177342 ; http://n2t.net/addgene:177342 ; RRID:Addgene_177342) -
For your References section:
Engineering of AAV-Mediated in Vivo Targeted DNA Methylation Editing System via Staphylococcus Aureus Derived Cas9-SunTag. Yamamoto N, Morita S, Hatada I, Ideta-Otsuka M, Tamura H, Narita M, Igarashi K. Research Square [Preprint] 2021. doi: 10.21203/rs.3.rs-1065603/v1. 10.21203/rs.3.rs-1065603/v1