Skip to main content
Addgene

AAV-CMV-scFVtet2_bGHpA
(Plasmid #177352)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 177352 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pX603-AAV-CMV_NLS-dSaCas9(D10A,N580A)-NLS-3xHA-bGHpA
  • Backbone manufacturer
    Addgene
  • Backbone size w/o insert (bp) 2597
  • Total vector size (bp) 6020
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Tet Methylcytosine Dioxygenase 2
  • Alt name
    TET2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3142
  • Mutation
    Catalytic domains of human TET2 (1129–1936 and 1481–1843 aa)
  • GenBank ID
  • Entrez Gene
    TET2 (a.k.a. IMD75, KIAA1546, MDS)
  • Promoter CMV promoter
  • Tags / Fusion Proteins
    • scFV (N terminal on insert)
    • myc (N terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer ACCCAGCTGGCGTAGTT
  • 3′ sequencing primer GGATGAGTTTGGGAGTGTGGAA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    scFV was cloned from pCAG-scFvGCN4sfGFPTET1CD which was a gift from Izuho Hatada (Addgene plasmid # 82561 ; http://n2t.net/addgene:82561 ; RRID:Addgene_82561)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.21203/rs.3.rs-1065603/v1 for preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-CMV-scFVtet2_bGHpA was a gift from Naoki Yamamoto (Addgene plasmid # 177352 ; http://n2t.net/addgene:177352 ; RRID:Addgene_177352)
  • For your References section:

    Engineering of AAV-Mediated in Vivo Targeted DNA Methylation Editing System via Staphylococcus Aureus Derived Cas9-SunTag. Yamamoto N, Morita S, Hatada I, Ideta-Otsuka M, Tamura H, Narita M, Igarashi K. Research Square [Preprint] 2021. doi: 10.21203/rs.3.rs-1065603/v1. 10.21203/rs.3.rs-1065603/v1