Skip to main content
Addgene

pSN554
(Plasmid #177361)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 177361 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET28a
  • Backbone size w/o insert (bp) 5282
  • Total vector size (bp) 7292
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    KIF1A
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2010
  • Entrez Gene
    KIF1A (a.k.a. ATSV, C2orf20, HSN2C, MRD9, NESCAVS, SPG30, UNC104)
  • Promoter T7
  • Tags / Fusion Proteins
    • Leucine zipper (C terminal on insert)
    • mScarlet (C terminal on insert)
    • StrepII tag (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CCTGTGGCGCCGGTGATGCCGG
  • 3′ sequencing primer GGCCCCAAGGGGTTATGCTAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSN554 was a gift from Shinsuke Niwa (Addgene plasmid # 177361 ; http://n2t.net/addgene:177361 ; RRID:Addgene_177361)
  • For your References section:

    De novo mutations in KIF1A-associated neuronal disorder (KAND) dominant-negatively inhibit motor activity and axonal transport of synaptic vesicle precursors. Anazawa Y, Kita T, Iguchi R, Hayashi K, Niwa S. Proc Natl Acad Sci U S A. 2022 Aug 9;119(32):e2113795119. doi: 10.1073/pnas.2113795119. Epub 2022 Aug 2. 10.1073/pnas.2113795119 PubMed 35917346