Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSN672
(Plasmid #177362)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 177362 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pET21a
  • Backbone size w/o insert (bp) 5352
  • Total vector size (bp) 6672
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    KIF1A
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1320
  • Entrez Gene
    KIF1A (a.k.a. ATSV, C2orf20, HSN2C, MRD9, NESCAVS, SPG30, UNC104)
  • Promoter T7
  • Tags / Fusion Proteins
    • Leucine zipper (C terminal on insert)
    • His tag (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ggaattgtgagcggataacaattcc
  • 3′ sequencing primer tcaagacccgtttagaggcccc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSN672 was a gift from Shinsuke Niwa (Addgene plasmid # 177362 ; http://n2t.net/addgene:177362 ; RRID:Addgene_177362)
  • For your References section:

    De novo mutations in KIF1A-associated neuronal disorder (KAND) dominant-negatively inhibit motor activity and axonal transport of synaptic vesicle precursors. Anazawa Y, Kita T, Iguchi R, Hayashi K, Niwa S. Proc Natl Acad Sci U S A. 2022 Aug 9;119(32):e2113795119. doi: 10.1073/pnas.2113795119. Epub 2022 Aug 2. 10.1073/pnas.2113795119 PubMed 35917346