Venus-Bcl2-pEGFP-C1
(Plasmid #177417)

• Purpose: To express Venus fused to the N-terminus of the Bcl-2 family protein, Bcl-2.
• Depositing Lab: David Andrews
• Publication: Aranovich et al Mol Cell. 2012 Mar 30;45(6):754-63. doi: 10.1016/j.molcel.2012.01.030.

Backbone

• Vector backbone: pEGFP-C1
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Bcl-2
• Alt name: VBcl2, VBcl-2, Venus-Bcl-2
• Species: H. sapiens (human)
• Entrez Gene: BCL2 (a.k.a. Bcl-2, PPP1R50)
• Promoter: CMV
• Tag / Fusion Protein:
  • Venus (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: TGACGCAAATGGGCGGTAGG
• 3′ sequencing primer: TCGCCCTTTGACGTTGGAGTCCAC

Resource Information

• Supplemental Documents:
  • Venus-Bcl2-pEGFP-C1
• A portion of this plasmid was derived from a plasmid made by: BCL-2 sequence aligns with Gene Bank #ABX60202.1, except there is a naturally occurring M157I alteration in the coding sequence of Bcl-2. The mutation was in the original clone and has been used to inhibit apoptosis by our group and many others around the world since that time. It has always been our assumption that this mutation is a naturally occurring variant. Our clone has been used in many publications as the plasmid was widely distributed when it was first assembled and published. Janiak F, Leber B, Andrews DW. Assembly of Bcl-2 into microsomal and outer mitochondrial membranes. J Biol Chem. 1994 Apr 1;269(13):9842-9. PMID: 8144576

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Transfection of this plasmid will express Venus-fused to the N-terminus of Bcl-2. There is a flexible, 6 aa linker between "SGLRST", between Venus and Bcl-2. This Venus protein contains an A206K mutation to make it monomeric.