Skip to main content

Venus-Bcl2-pEGFP-C1
(Plasmid #177417)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 177417 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-C1
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Bcl-2
  • Alt name
    VBcl2, VBcl-2, Venus-Bcl-2
  • Species
    H. sapiens (human)
  • Entrez Gene
    BCL2 (a.k.a. Bcl-2, PPP1R50)
  • Promoter CMV
  • Tag / Fusion Protein
    • Venus (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer TGACGCAAATGGGCGGTAGG
  • 3′ sequencing primer TCGCCCTTTGACGTTGGAGTCCAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    BCL-2 sequence aligns with Gene Bank #ABX60202.1, except there is a naturally occurring M157I alteration in the coding sequence of Bcl-2. The mutation was in the original clone and has been used to inhibit apoptosis by our group and many others around the world since that time. It has always been our assumption that this mutation is a naturally occurring variant. Our clone has been used in many publications as the plasmid was widely distributed when it was first assembled and published. Janiak F, Leber B, Andrews DW. Assembly of Bcl-2 into microsomal and outer mitochondrial membranes. J Biol Chem. 1994 Apr 1;269(13):9842-9. PMID: 8144576

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Transfection of this plasmid will express Venus-fused to the N-terminus of Bcl-2. There is a flexible, 6 aa linker between "SGLRST", between Venus and Bcl-2. This Venus protein contains an A206K mutation to make it monomeric.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Venus-Bcl2-pEGFP-C1 was a gift from David Andrews (Addgene plasmid # 177417 ; http://n2t.net/addgene:177417 ; RRID:Addgene_177417)
  • For your References section:

    Differences in the mechanisms of proapoptotic BH3 proteins binding to Bcl-XL and Bcl-2 quantified in live MCF-7 cells. Aranovich A, Liu Q, Collins T, Geng F, Dixit S, Leber B, Andrews DW. Mol Cell. 2012 Mar 30;45(6):754-63. doi: 10.1016/j.molcel.2012.01.030. 10.1016/j.molcel.2012.01.030 PubMed 22464442