Skip to main content

PIG-Myc
(Plasmid #177650)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 177650 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    MSCV
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 7657
  • Total vector size (bp) 8966
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin ; GFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Myc
  • Alt name
    cMyc
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1320
  • GenBank ID
    NM_001177352.1
  • Entrez Gene
    Myc (a.k.a. Myc2, Niard, Nird, bHLHe39)
  • Tags / Fusion Proteins
    • IRES (C terminal on backbone)
    • GFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer pBabe 5' CTTTATCCAGCCCTCAC
  • 3′ sequencing primer MSCV-rev CAGCGGGGCTGCTAAAGCGCATGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PIG-Myc was a gift from Trudy Oliver (Addgene plasmid # 177650 ; http://n2t.net/addgene:177650 ; RRID:Addgene_177650)
  • For your References section:

    MYC Drives Progression of Small Cell Lung Cancer to a Variant Neuroendocrine Subtype with Vulnerability to Aurora Kinase Inhibition. Mollaoglu G, Guthrie MR, Bohm S, Bragelmann J, Can I, Ballieu PM, Marx A, George J, Heinen C, Chalishazar MD, Cheng H, Ireland AS, Denning KE, Mukhopadhyay A, Vahrenkamp JM, Berrett KC, Mosbruger TL, Wang J, Kohan JL, Salama ME, Witt BL, Peifer M, Thomas RK, Gertz J, Johnson JE, Gazdar AF, Wechsler-Reya RJ, Sos ML, Oliver TG. Cancer Cell. 2017 Feb 13;31(2):270-285. doi: 10.1016/j.ccell.2016.12.005. Epub 2017 Jan 12. 10.1016/j.ccell.2016.12.005 PubMed 28089889