YN2_1_LT84_RPL13A
(Plasmid
#177712)
-
PurposeExpresses Cas9 and sgRNA cassette for targeting RPL13A in yeast Saccharomyces cerevisiae
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 177712 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneEmpty backbone
- Total vector size (bp) 9423
-
Vector typeYeast Expression, CRISPR
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas9
-
gRNA/shRNA sequenceGAAGGAAAATACAAAAATTG
-
SpeciesS. cerevisiae (budding yeast)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
YN2_1_LT84_RPL13A was a gift from Lisbeth Olsson (Addgene plasmid # 177712 ; http://n2t.net/addgene:177712 ; RRID:Addgene_177712) -
For your References section:
Real-Time Monitoring of the Yeast Intracellular State During Bioprocesses With a Toolbox of Biosensors. Torello Pianale L, Rugbjerg P, Olsson L. Front Microbiol. 2022 Jan 7;12:802169. doi: 10.3389/fmicb.2021.802169. eCollection 2021. 10.3389/fmicb.2021.802169 PubMed 35069506