Skip to main content

pEFS-ccdB-12X MS2_mPGK-Puro
(Plasmid #177809)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 177809 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC19
  • Backbone size (bp) 2686
  • Vector type
    Mammalian Expression
  • Promoter EFS
  • Selectable markers
    Puromycin
  • Tag / Fusion Protein
    • 12X MS2 stem loops (C terminal on insert)

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer TAAGTTGGGTAACGCCAGGG
  • 3′ sequencing primer GCTCGTATGTTGTGTGGAAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid was designed to tag transcripts of insert at the 3' with an 12X MS2 stem loop tag. Insertion of the transcript of interst is performed by BsaI cloning.
5' BsaI generates ACAG overhang (BsaI recognition site 2659-2664)
3' BsaI generates CCCG overhang (BsaI recognition site 4086-4091)

These BsaI sites are lost upon insertion of the transcript of interest.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEFS-ccdB-12X MS2_mPGK-Puro was a gift from Sven Eyckerman (Addgene plasmid # 177809 ; http://n2t.net/addgene:177809 ; RRID:Addgene_177809)
  • For your References section:

    Orthogonal proteomics methods to unravel the HOTAIR interactome. Delhaye L, De Bruycker E, Volders PJ, Fijalkowska D, De Sutter D, Degroeve S, Martens L, Mestdagh P, Eyckerman S. Sci Rep. 2022 Jan 27;12(1):1513. doi: 10.1038/s41598-022-05405-6. 10.1038/s41598-022-05405-6 PubMed 35087108