Skip to main content
Addgene

pLV-hSyn1-GFP
(Plasmid #177810)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 177810 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLV
  • Backbone size w/o insert (bp) 8500
  • Total vector size (bp) 9210
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CopGFP inserted behind human synapsin I promoter
  • Alt name
    SYN1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    699
  • Entrez Gene
    SYN1 (a.k.a. EPILX, EPILX1, MRX50, SYN1a, SYN1b, SYNI)
  • Promoter Syn1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site PmeI (destroyed during cloning)
  • 5′ sequencing primer agtcgtgtcgtgcctgagag
  • 3′ sequencing primer tgttgctccttttacgctatg
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Vector derived from pLV-hSyn-RFP (Addgene Plasmid #22909)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV-hSyn1-GFP was a gift from Christopher Grigsby (Addgene plasmid # 177810 ; http://n2t.net/addgene:177810 ; RRID:Addgene_177810)
  • For your References section:

    Enhanced efficiency of nonviral direct neuronal reprogramming on topographical patterns. Mattiassi S, Rizwan M, Grigsby CL, Zaw AM, Leong KW, Yim EKF. Biomater Sci. 2021 Aug 7;9(15):5175-5191. doi: 10.1039/d1bm00400j. Epub 2021 Jun 15. 10.1039/d1bm00400j PubMed 34128504