pFAST-BAC BAF155/SMARCC1-His
(Plasmid #177863)

• Purpose: Transfer vector to generate recombinant baculovirus expressing BAF155/SMARCC1-His
• Depositing Lab: Yoshihiro Izumiya
• Publication: Shimoda et al Commun Biol. 2021 Dec 2;4(1):1330. doi: 10.1038/s42003-021-02853-0.

Backbone

• Vector backbone: pFAST BAC1
• Backbone size w/o insert (bp): 4775
• Total vector size (bp): 8100
• Vector type: Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SMARCC1
• Alt name: BAF155
• Species: H. sapiens (human)
• Insert Size (bp): 3390
• GenBank ID: NM_003074.4
• Entrez Gene: SMARCC1 (a.k.a. BAF155, CRACC1, Rsc8, SRG3, SWI3)
• Promoter: polyhedrin
• Tags / Fusion Proteins:
  • His tag at C-terminus with GGGGS linker (C terminal on insert)
  • His (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: pFAST-BAC seq-Fw: aaatgataaccatctcgc
• 3′ sequencing primer: pFAST-BAC seq-Rv: tgtttcaggttcagggggag

Resource Information

• A portion of this plasmid was derived from a plasmid made by: pBS hBAF155 (Plasmid#17876) from addgene as template

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry