Skip to main content

mTln1-F2F3-P229L-pET151
(Plasmid #177879)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 177879 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET151
  • Backbone size w/o insert (bp) 5742
  • Total vector size (bp) 6390
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mouse Talin 1 F2F3 P229L mutant
  • Alt name
    mTln1-F2F3-P229L
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    648
  • Mutation
    changed Proline 229 to Leucine (P229L)
  • GenBank ID
    NC_000070.7
  • Entrez Gene
    Tln1 (a.k.a. Tln)
  • Promoter T7
  • Tag / Fusion Protein
    • His-tag, TEV cleavage site (N terminal on backbone)

Cloning Information

  • Cloning method TOPO Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mTln1-F2F3-P229L-pET151 was a gift from Ben Goult (Addgene plasmid # 177879 ; http://n2t.net/addgene:177879 ; RRID:Addgene_177879)
  • For your References section:

    Talin variant P229S compromises integrin activation and associates with multifaceted clinical symptoms. Azizi L, Varela L, Turkki P, Mykuliak VV, Korpela S, Ihalainen TO, Church J, Hytonen VP, Goult BT. Hum Mol Genet. 2022 Jul 21. pii: 6647920. doi: 10.1093/hmg/ddac163. 10.1093/hmg/ddac163 PubMed 35861643