-
PurposeHT-iPAK4 fusion with CMV promoter, cloned into a lentivirus backbone
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 177882 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLenti CMV
- Total vector size (bp) 10509
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameiPAK4
-
SpeciesSynthetic
-
Insert Size (bp)1971
- Promoter CMV
-
Tag
/ Fusion Protein
- HaloTag (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTTCGGGTTTATTACAGGGACAG
- 3′ sequencing primer GATATCGAATTCTCATCTGGTGCG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note: Plasmid contains a T135I mutation in the Halo Tag. This mutation is not known to affect protein function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
DL017:CMV::HaloTag-iPAK4 was a gift from Adam Cohen (Addgene plasmid # 177882 ; http://n2t.net/addgene:177882 ; RRID:Addgene_177882) -
For your References section:
Time-tagged ticker tapes for intracellular recordings. Lin D, Li X, Moult E, Park P, Tang B, Shen H, Grimm JB, Falco N, Jia BZ, Baker D, Lavis LD, Cohen AE. Nat Biotechnol. 2023 Jan 2. doi: 10.1038/s41587-022-01524-7. 10.1038/s41587-022-01524-7 PubMed 36593408