Skip to main content

DL017:CMV::HaloTag-iPAK4
(Plasmid #177882)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 177882 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLenti CMV
  • Total vector size (bp) 10509
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    iPAK4
  • Species
    Synthetic
  • Insert Size (bp)
    1971
  • Promoter CMV
  • Tag / Fusion Protein
    • HaloTag (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TTTCGGGTTTATTACAGGGACAG
  • 3′ sequencing primer GATATCGAATTCTCATCTGGTGCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note: Plasmid contains a T135I mutation in the Halo Tag. This mutation is not known to affect protein function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    DL017:CMV::HaloTag-iPAK4 was a gift from Adam Cohen (Addgene plasmid # 177882 ; http://n2t.net/addgene:177882 ; RRID:Addgene_177882)
  • For your References section:

    Time-tagged ticker tapes for intracellular recordings. Lin D, Li X, Moult E, Park P, Tang B, Shen H, Grimm JB, Falco N, Jia BZ, Baker D, Lavis LD, Cohen AE. Nat Biotechnol. 2023 Jan 2. doi: 10.1038/s41587-022-01524-7. 10.1038/s41587-022-01524-7 PubMed 36593408